View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11931_high_5 (Length: 287)
Name: NF11931_high_5
Description: NF11931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11931_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 43366857 - 43367016
Alignment:
| Q |
1 |
agagagagcatgatgaaaagaaggagaaggcagacggagatggcggaaatgaggaggcggtgaatgagacgacggcggaggaaactggcaagaaggagtc |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43366857 |
agagagagcatgatgaaaagaaagagaaggcagacggagatggaggaaatgaggaggcgatgaatgagacgacggcggaggaaactggaaagaaggagtc |
43366956 |
T |
 |
| Q |
101 |
cgatgagtcttctggacttgtctgtcttctttctcttcactgatgatggtgtatgcatca |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43366957 |
cgatgagtcttctggacttgtctgtcttctttctcttcactgatgatggtttatgcatca |
43367016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 194 - 232
Target Start/End: Original strand, 43367042 - 43367080
Alignment:
| Q |
194 |
gaatgaatattaattacagtttggtgtatgtatatatgt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43367042 |
gaatgaatattaattacagtttggtgtatgtatgtatgt |
43367080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University