View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11931_low_7 (Length: 258)
Name: NF11931_low_7
Description: NF11931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11931_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 247
Target Start/End: Original strand, 46217067 - 46217298
Alignment:
| Q |
16 |
aaaaaataggttgaaaagttcagcgcagtttaacaaattcaatcgattagaacaacgcaccagtatcgaacagatttgcacttggcgcagcgcgcagtgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46217067 |
aaaaaataggttgaaaagttcagcgcagtttaacaaattcaatcgattagaacaacgcaccagtatcgaacagatttgcacttagcgcagcgcgcagtgg |
46217166 |
T |
|
| Q |
116 |
caggaaaatagcagagagcacattgataattgttagtggcggaaaccaccgcaccggaggaatacaacgtctctctctcaaccctggcagtttcctcagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46217167 |
caggaaaatagcagagagcacattgataattgttagtggcggaaaccaccgcaccggaggaatacaacgtctctctctcaaccctggcagtttcctcagc |
46217266 |
T |
|
| Q |
216 |
agccaaaatcaagagccccttgatctcttcat |
247 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
46217267 |
agccaaaatcaagagcctcttgatctcttcat |
46217298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University