View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11931_low_7 (Length: 258)

Name: NF11931_low_7
Description: NF11931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11931_low_7
NF11931_low_7
[»] chr3 (1 HSPs)
chr3 (16-247)||(46217067-46217298)


Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 247
Target Start/End: Original strand, 46217067 - 46217298
Alignment:
16 aaaaaataggttgaaaagttcagcgcagtttaacaaattcaatcgattagaacaacgcaccagtatcgaacagatttgcacttggcgcagcgcgcagtgg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
46217067 aaaaaataggttgaaaagttcagcgcagtttaacaaattcaatcgattagaacaacgcaccagtatcgaacagatttgcacttagcgcagcgcgcagtgg 46217166  T
116 caggaaaatagcagagagcacattgataattgttagtggcggaaaccaccgcaccggaggaatacaacgtctctctctcaaccctggcagtttcctcagc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46217167 caggaaaatagcagagagcacattgataattgttagtggcggaaaccaccgcaccggaggaatacaacgtctctctctcaaccctggcagtttcctcagc 46217266  T
216 agccaaaatcaagagccccttgatctcttcat 247  Q
    ||||||||||||||||| ||||||||||||||    
46217267 agccaaaatcaagagcctcttgatctcttcat 46217298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University