View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11931_low_9 (Length: 239)
Name: NF11931_low_9
Description: NF11931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11931_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 31403492 - 31403719
Alignment:
| Q |
1 |
aagtaagtcaatctaaatagacctttatgcggatgctgctgagcttggtgggtacgagaatgcgatacttgatgccagttgctagaatattgcttcaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31403492 |
aagtaagtcaatctaaatagacctttatgcggatgctgctgagcttggtgggtacgagaatgcgatacttgatgccagttgctagaatattgcttcaaat |
31403591 |
T |
 |
| Q |
101 |
gatgaaatatggc-----gtggctgagtccatggtagattgattcatttccattatattttcttttaaatggtttggcttcataggaacttttaatatct |
195 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31403592 |
gatgaaatatggcatcaagtggctgagtccatggtagattgattcatttccattattattttttttgaatggtttggcttcataggaacttttaatatct |
31403691 |
T |
 |
| Q |
196 |
tcacatgttaaatacggtgtgaaatttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31403692 |
tcacatgttaaatacggtgtgaaatttt |
31403719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 112
Target Start/End: Complemental strand, 31337119 - 31337038
Alignment:
| Q |
31 |
ggatgctgctgagcttggtgggtacgagaatgcgatacttgatgccagttgctagaatattgcttcaaatgatgaaatatgg |
112 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||| ||||| ||||||||||| | |||||||| ||||| |
|
|
| T |
31337119 |
ggatgctgctgagcttggtgggtttgaggatgtgatacttgatgcctgttgccagaatattgctgccgatgatgaagtatgg |
31337038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University