View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_high_48 (Length: 337)
Name: NF11932_high_48
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 328
Target Start/End: Original strand, 23769487 - 23769796
Alignment:
| Q |
19 |
atttctcccattgcctttgtgaacacataagtatcttgccatccatatcttctagccctatatagaaaaatcaaatcaaattaagcttgtgagttttaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23769487 |
atttctcccattgcctttgtgaacacataagtatcttgccatccatatcttctagccctatatagaaaaatcaaatcaaattaagcttgtgagttttaag |
23769586 |
T |
 |
| Q |
119 |
aatattcacttaattgatggataaatagatacgttagtttcgagaaaacaaatatagatacattatttaagnnnnnnnnaaccatctgatttttcaggga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
23769587 |
aatattcacttaattgatggataaatagatacgttagtttcgagaaaacaaatatagatgcattatttaagttttttttaaccatctgatttttcaggga |
23769686 |
T |
 |
| Q |
219 |
aaaggagttctcgtaattcataattcgatcagaaggtaagtaaagccttattgatgaatgtaaaacataggatcactaaaaatacctctctagacccatc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23769687 |
aaaggagttctcgtaattcataattcgatcagaaggtaagtaaagtcttattgatgaatgtgaaacatagggtcactaaaaatacctctctagacccatc |
23769786 |
T |
 |
| Q |
319 |
tccttcatct |
328 |
Q |
| |
|
|||||||||| |
|
|
| T |
23769787 |
tccttcatct |
23769796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University