View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_high_52 (Length: 322)
Name: NF11932_high_52
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_high_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 42273492 - 42273660
Alignment:
| Q |
19 |
gttgcgatgccatgaccaatgtgcatgagtttcattcagtattcgtaaccttccatgaccgaagcttggctctcgaaacaatgagagtggacttggagga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42273492 |
gttgcgatgccatgaccaatgtgcatgagtttcattcagtattcgtaaccttccatgaccgaagcttggctctcgaaacaatgagagtggacttggagga |
42273591 |
T |
|
| Q |
119 |
ttcttaaacctatgatcagcaagcaatatataataatatttcaggtccctgaagaaatttacattgact |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42273592 |
ttcttaaacctatgatcagcaagcaatatataataatatttcaggtcccagaagaaatttacattgact |
42273660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 249 - 322
Target Start/End: Original strand, 42273722 - 42273795
Alignment:
| Q |
249 |
cttcaccttagtgcaagtccctcgcggtttcctccatccccaattgtcacatacattggaccgcatgaatcagc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42273722 |
cttcaccttagtgcaagtccctcgcggtttcctccatccccaattgtcacatacattggaccgcatgaatcagc |
42273795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 23 - 131
Target Start/End: Complemental strand, 26276904 - 26276796
Alignment:
| Q |
23 |
cgatgccatgaccaatgtgcatgagtttcattcagtattcgtaaccttccatgaccgaagcttggctctcgaaacaatgagagtggacttggaggattct |
122 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||| ||||| |||||||||||||| ||||||| ||||| | |||||||||||||||||||||| |||| |
|
|
| T |
26276904 |
cgatgccatgaccaatttgcatgtgtttcgttcactattctcaaccttccatgaccaaagcttgcctctctatacaatgagagtggacttggaggcttct |
26276805 |
T |
|
| Q |
123 |
taaacctat |
131 |
Q |
| |
|
||||||||| |
|
|
| T |
26276804 |
taaacctat |
26276796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 251 - 322
Target Start/End: Complemental strand, 26276671 - 26276600
Alignment:
| Q |
251 |
tcaccttagtgcaagtccctcgcggtttcctccatccccaattgtcacatacattggaccgcatgaatcagc |
322 |
Q |
| |
|
|||| ||| ||||||||| || |||||||||||||| ||||||||||| |||| ||||| |||| |||||| |
|
|
| T |
26276671 |
tcactttaatgcaagtccttcacggtttcctccatcaccaattgtcacgtacaacggaccacatggatcagc |
26276600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University