View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_high_57 (Length: 293)
Name: NF11932_high_57
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_high_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 386241 - 385963
Alignment:
| Q |
1 |
ctgacacctaacaagatgcgctaaaatcgaagtgtaaagaatcaaatcaacttttgcagcggagttaacatatgtttcaagaagtggcttggctgactcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386241 |
ctgacacctaacaagatgcgctaaaatcgaagtgtaaagaatgaaatcaacttttgcagcggagttaacatatgtttcaagaagtggcttggctgactcg |
386142 |
T |
|
| Q |
101 |
tatatcccattcttcatgcatgactcaaacaactgtcggattataaaattatttgttctgatacctgacgaacccatgaaacgcagccacctcaaagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386141 |
tatatcccattcttcatgcatgactcaaacaactgtcggattataaaattatttgttctgatacctgacgaacccatgaaacgcagccacctcaaagcaa |
386042 |
T |
|
| Q |
201 |
gatcaaccgaaccttccttgatatacaccatcaaaacatcactagctgtcacatccacagaatatcccatggtcttcat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
386041 |
gatcaaccgaaccttccttgatatacaccatcaaaacatcactagctgtcacatccacagaatatcccatcgtcttcat |
385963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 38729301 - 38729579
Alignment:
| Q |
1 |
ctgacacctaacaagatgcgctaaaatcgaagtgtaaagaatcaaatcaacttttgcagcggagttaacatatgtttcaagaagtggcttggctgactcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||| |
|
|
| T |
38729301 |
ctgacacctaacaagatgcgctaaaatcgaagtgtaaagtatcaaatcaacttttgcagcggagttcacatatgtttcaagaagaggcttggctgattcg |
38729400 |
T |
|
| Q |
101 |
tatatcccattcttcatgcatgactcaaacaactgtcggattataaaattatttgttctgatacctgacgaacccatgaaacgcagccacctcaaagcaa |
200 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| | ||||||||||||||| |||||||| ||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
38729401 |
tatatcccatttttcatgcacgactcaaacaactgcctgattataaaattattggttctgatccctgaggaacccatgaaacgtagccatctcaaagcaa |
38729500 |
T |
|
| Q |
201 |
gatcaaccgaaccttccttgatatacaccatcaaaacatcactagctgtcacatccacagaatatcccatggtcttcat |
279 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38729501 |
gatcgactgaaccttccttgatatacaccatcaaaacatcactagctgtcacatccacagaatatcccattgtcttcat |
38729579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University