View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_high_70 (Length: 252)
Name: NF11932_high_70
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_high_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 7161027 - 7161263
Alignment:
| Q |
1 |
ttacaacatctcccaccgtttgaacgtcttccattcttgaagtt-attcatttaaatttgcttgatgaattggagtatatgtattatgaaaagctccttt |
99 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||| | | |||||||| ||||| ||||||||||||| |
|
|
| T |
7161027 |
ttacaatatctcccaccgttggaacgtcttccattcttgaagtttattcatttaaattcgctccttaa----gagtatatatattacgaaaagctccttt |
7161122 |
T |
 |
| Q |
100 |
cgcctgaaatattctttccgtctttagagaggctccttttatgcaagtgcaaaaagttgaggggatggtggaggatgggagatgatgtcaatgacaatga |
199 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
7161123 |
tgcctgagatattctttccatctttagagaggctccttttgtgcaagtgcaaaaagttgaggggatggtggaggttgggagctgatgtcaatgacaatga |
7161222 |
T |
 |
| Q |
200 |
tactgatgactcgtcaaaatcacataatctctccgtccctt |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
7161223 |
tactgataactcgtcaaaatcacataatctctctgtccctt |
7161263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 98 - 193
Target Start/End: Complemental strand, 3917605 - 3917510
Alignment:
| Q |
98 |
ttcgcctgaaatattctttccgtctttagagaggctccttttatgcaagtgcaaaaagttgaggggatggtggaggatgggagatgatgtcaatga |
193 |
Q |
| |
|
||||||||||| |||||| || | |||| |||| ||| || |||| || ||||| ||||||||||||||||||| |||| | |||||||||||||| |
|
|
| T |
3917605 |
ttcgcctgaaacattcttcccatgtttaaagagtctctttatatggaaatgcaataagttgaggggatggtggaagatgagtgatgatgtcaatga |
3917510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 3280888 - 3280852
Alignment:
| Q |
155 |
gttgaggggatggtggaggatgggagatgatgtcaat |
191 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
3280888 |
gttgaagggatggtggaggatgggagatgatttcaat |
3280852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University