View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_high_71 (Length: 252)
Name: NF11932_high_71
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_high_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 8600777 - 8600581
Alignment:
| Q |
1 |
ctgatttcagattgtgaatgaaatacactgaaatatttataaaatagtagaatattaaccatttttattaacaatttactttccgaaat-gaaaacttta |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
8600777 |
ctgatttcagattgagaatgaaatacactgaaatctttataaaatagtagaatattaaccatttttattaacgatttactttccaaaattgaaaacttta |
8600678 |
T |
 |
| Q |
100 |
tgttgagggaaccattatttcacagaaccgaaccatcatgacttctatcctgtagcatatttatacaaattttgtaatcaaaatgttttttcttagc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8600677 |
tgttgagggaaccattatttcacagaaccgaaccatcatgacttctatcctgtagcatgtttatacaaattttgcaatcaaaatgttttttcttagc |
8600581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University