View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_high_88 (Length: 233)
Name: NF11932_high_88
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_high_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 54271912 - 54272085
Alignment:
| Q |
20 |
gtttcttatacgtcggtcaaatgggcttctccggtggagtttgctactggtggatatggatttggtcttcattggtgggatcagagaaaacctggtggac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54271912 |
gtttcttatacgtcggtcaaatgggcttctccggtggagtttgctactggtggatatggatttggtcttcattggtgggatcagagaaaacctggtggac |
54272011 |
T |
 |
| Q |
120 |
cggtttctcagttcaagggtaactggtaagaaaaatgttgagcctttagttacttaattgtcgagccttgactt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54272012 |
cggtttctcagttcaagggtaactggtaagaaaaatgttgagcctttagttacttaattgtcgagccttgactt |
54272085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University