View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_high_93 (Length: 228)
Name: NF11932_high_93
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_high_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5692983 - 5692761
Alignment:
| Q |
1 |
actagacatctttataatatagttcactaattaactcatgactttatgttatacagtgttaattctccnnnnnnnnnnnnnnnnnctcgagaaagaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5692983 |
actagacatctttataatatagttcactaattaactcatgactttatgttatacagtgttaattctccttttcttttcattttttctcgagaaagaaaaa |
5692884 |
T |
 |
| Q |
101 |
gttgagggcatgatcacatttggcatgaaatatttgtcacttcatgtaagggaaaagtcgatgtacaacgcgggaaat-aaagggttttgtgaatggatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5692883 |
gttgagggcatgatcacatttggcatgaaatatttgtcacttcatgtaagggaaaagtcgatgtacaacgcgggaaataaaagggttttgtgaatggatg |
5692784 |
T |
 |
| Q |
200 |
acagtcccaaacacagttgaatt |
222 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
5692783 |
acagtgccaaacacagttgaatt |
5692761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University