View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11932_high_95 (Length: 226)

Name: NF11932_high_95
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11932_high_95
NF11932_high_95
[»] chr4 (4 HSPs)
chr4 (18-210)||(37989542-37989734)
chr4 (118-210)||(38013259-38013351)
chr4 (136-192)||(37697748-37697804)
chr4 (110-207)||(37993735-37993832)
[»] chr1 (1 HSPs)
chr1 (173-205)||(18138354-18138386)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 37989734 - 37989542
Alignment:
18 ggaattgggacaggtttggggaggctgatgttgcggagatcaagactagtgatacggtaggttcggttgtagttgtcacaatcaacacctagccatgtac 117  Q
    ||||||||||||||||| |||||| |||||||   |||||||||||  ||||||||||||||||||||| ||||||||||||| ||||||||||||||||    
37989734 ggaattgggacaggtttagggaggttgatgttttcgagatcaagaccggtgatacggtaggttcggttgaagttgtcacaatctacacctagccatgtac 37989635  T
118 tgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcatctg 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37989634 tgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcatctg 37989542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 118 - 210
Target Start/End: Complemental strand, 38013351 - 38013259
Alignment:
118 tgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcatctg 210  Q
    |||| ||||||||  || ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||    
38013351 tgttgcagcagtctgtgtttggatcccatgaagagagttggctagggttgccaaattcttttttgatttggagtagggttcttttgtcatctg 38013259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 37697748 - 37697804
Alignment:
136 ttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagta 192  Q
    ||||||||||||||||||||| | | ||||||||||||||||| || ||||||||||    
37697748 ttggatcccatgaagagagtttggttgggttgccaaattcttttttgatttggagta 37697804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 37993832 - 37993735
Alignment:
110 ccatgtactgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcat 207  Q
    |||||| | ||| ||||||||| | |||| ||||||||||||||||| | | ||||||||||||| ||| || ||||| |  |||||| |||||||||    
37993832 ccatgttccgttgcagcagtcggtagttgaatcccatgaagagagtttggttgggttgccaaattgttttttgatttgaaagagggtttttttgtcat 37993735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 18138386 - 18138354
Alignment:
173 ttctttctttatttggagtagggttcttttgtc 205  Q
    ||||||||| |||||||||||||||||||||||    
18138386 ttctttcttgatttggagtagggttcttttgtc 18138354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University