View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_35 (Length: 423)
Name: NF11932_low_35
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 182 - 408
Target Start/End: Complemental strand, 41724528 - 41724299
Alignment:
| Q |
182 |
caagtattgctatttttgaagtgtgatttgggtgtggtgttga---gggtaagaaacaagacaatgagaaaaagagtctgtttatgcatgtcattttctt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41724528 |
caagtattgctatttttgaagtgtgatttgggtgtggtgttgatgagggtaagaaacaagacaatgagaaaaagagtctgtttatgcatgtcattttctt |
41724429 |
T |
|
| Q |
279 |
ccaactgcatgcatgtcctcttcgatggctatcatgataaattaacacaggccatttatctagaaaaacagttggtctatgaaacgggatgtggatcaaa |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41724428 |
ccaactgcatgcatgtcctcttcgatggctatcatgataaattaacacaggccatttatctagaaaaacagttggtctatgaaacgggatgtggatcaaa |
41724329 |
T |
|
| Q |
379 |
ttcctcgttaacaagacaatatcgtttttg |
408 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
41724328 |
ttcctctttaacaagacaatatcgtttttg |
41724299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University