View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_53 (Length: 328)
Name: NF11932_low_53
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 197 - 324
Target Start/End: Complemental strand, 16212185 - 16212058
Alignment:
| Q |
197 |
atgtatcagtttacatatcttaaaatctcatgaataaaagcagaacaagttcaaaattatatatttttcctttttggtaaacgtctcaatttgaatctca |
296 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16212185 |
atgtataagtttacatatcttaaaatctcatgaataaaagcagaacaagttcaaaattatttatttttcctttttgttaaacgtctcaatttgaatctca |
16212086 |
T |
|
| Q |
297 |
cttgctttgcacacattctctgcttctc |
324 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
16212085 |
cttgctttgcacacattctttgcttctc |
16212058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 18 - 134
Target Start/End: Complemental strand, 16212299 - 16212183
Alignment:
| Q |
18 |
acgaagccggttttacaacaatgagactaaattcaaaacctaattaacaagaaaacatccaaattcttacataaagtatatgctcctttgtcggactaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
16212299 |
acgaagccggttttacaacaatgagactaaattcaaaacctaattaacaagaaaacatccaaattcttacataatgtataagctcctttgtcggactaca |
16212200 |
T |
|
| Q |
118 |
agcacatatttacaatg |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16212199 |
agcacatatttacaatg |
16212183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University