View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_56 (Length: 310)
Name: NF11932_low_56
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_56 |
 |  |
|
| [»] chr7 (6 HSPs) |
 |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 57 - 310
Target Start/End: Complemental strand, 37366287 - 37366032
Alignment:
| Q |
57 |
tatatgtgttgatgagaagaaacttgcttatacatctttgtcaaaatgggagacgatacatttt--cattgaaaacttttaagtcataaggtaaatgagt |
154 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
37366287 |
tatatatgttgatgagaagaaacttgcttatacatctttgtcaaaaagggagacgatacattttttcatcgaaaacttttaagtcataaggtaaatgagt |
37366188 |
T |
 |
| Q |
155 |
catttcttttttacagtcgacttggacacttaatcacttacactttcttgtgtaggaaaattgagtgtactctggttaaaaacccaacaggttcaactgg |
254 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37366187 |
catttcttttttatagtcgacttggacacttaatcacttacactttcttgtgtaggaaaattgagtgtactctggttaaaaacccaacaggttcaactgg |
37366088 |
T |
 |
| Q |
255 |
tgctgtctctcttaaactctttgcaagtagttgtcatatgaaaaacttgctttctc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37366087 |
tgctgtctctcttaaactctttgcaagtagttgtcatatgaaaaacttgctttctc |
37366032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 44479935 - 44479966
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44479935 |
tgtgtgtcagagtcaactaggtcacttattta |
44479966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 47713717 - 47713748
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47713717 |
tgtgtgtcagagtcaactaggtcacttattta |
47713748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 47713794 - 47713825
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47713794 |
tgtgtgtcagagtcaactaggtcacttattta |
47713825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 32
Target Start/End: Original strand, 23474185 - 23474215
Alignment:
| Q |
2 |
gtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23474185 |
gtgtgtcagagtcaactaggtcacttattta |
23474215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 32
Target Start/End: Original strand, 31466574 - 31466604
Alignment:
| Q |
2 |
gtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31466574 |
gtgtgtcagagtcaactaggtcacttattta |
31466604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 12798 - 12767
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12798 |
tgtgtgtcagagtcaactaggtcacttattta |
12767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 10439 - 10408
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10439 |
tgtgtgtcagagtcaactaggtcacttattta |
10408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 5364466 - 5364435
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5364466 |
tgtgtgtcagagtcaactaggtcacttattta |
5364435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 40512895 - 40512926
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40512895 |
tgtgtgtcagagtcaactaggtcacttattta |
40512926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 30
Target Start/End: Original strand, 5213138 - 5213166
Alignment:
| Q |
2 |
gtgtgtcagagtcaactaggtcacttatt |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5213138 |
gtgtgtcagagtcaactaggtcacttatt |
5213166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 38833710 - 38833679
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38833710 |
tgtgtgtcagagtcaactaggtcacttattta |
38833679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 51062436 - 51062405
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51062436 |
tgtgtgtcagagtcaactaggtcacttattta |
51062405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 34827367 - 34827339
Alignment:
| Q |
2 |
gtgtgtcagagtcaactaggtcacttatt |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34827367 |
gtgtgtcagagtcaactaggtcacttatt |
34827339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 38492097 - 38492069
Alignment:
| Q |
2 |
gtgtgtcagagtcaactaggtcacttatt |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38492097 |
gtgtgtcagagtcaactaggtcacttatt |
38492069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 42038569 - 42038538
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttattta |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42038569 |
tgtgtgtcagagtcaactaggtcacttattta |
42038538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 30
Target Start/End: Original strand, 7443107 - 7443135
Alignment:
| Q |
2 |
gtgtgtcagagtcaactaggtcacttatt |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7443107 |
gtgtgtcagagtcaactaggtcacttatt |
7443135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 2986385 - 2986356
Alignment:
| Q |
1 |
tgtgtgtcagagtcaactaggtcacttatt |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2986385 |
tgtgtgtcagagtcaactaggtcacttatt |
2986356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 18991949 - 18991921
Alignment:
| Q |
2 |
gtgtgtcagagtcaactaggtcacttatt |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18991949 |
gtgtgtcagagtcaactaggtcacttatt |
18991921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University