View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_57 (Length: 302)
Name: NF11932_low_57
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 60 - 285
Target Start/End: Original strand, 10239180 - 10239408
Alignment:
| Q |
60 |
caagttgacacaagttatattatgaatttgttttataccatattaattaataagagcttgcttgtaacccacatgcattgtcacattttatgcttaaatt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10239180 |
caagttgacacaagttatattatgaatttgttttataccatattaattaataagagcttgcttgtaacccacatgcattgtcacattttatgctaaaatt |
10239279 |
T |
 |
| Q |
160 |
gatttttctatgataattttcaatattaggccaaatga---atcatcataattagaaatttgcaactcatttgctttcatctgttggtgttggctccgat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10239280 |
gatttttctatgataattttcaatattaggccaaatgaatcatcatcatatttagaaatttgcaactcatttgccttcatctgttggtgttggctccgat |
10239379 |
T |
 |
| Q |
257 |
ctcccatagcaaaacaagggagttattat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10239380 |
ctcccatagcaaaacaagggagttattat |
10239408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University