View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_66 (Length: 269)
Name: NF11932_low_66
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 14022000 - 14021751
Alignment:
| Q |
1 |
gttggaaatggtaaagcaaggtatagagagtgtctgaagaatcatgctgtaggtattggtggtcatgctcttgatggttgcggtgagtttatgccggcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14022000 |
gttggaaatggtaaagcaaggtatagagagtgtctgaagaatcatgctgtaggtattgggggtcatgctcttgatggttgcggtgagtttatgccggcag |
14021901 |
T |
|
| Q |
101 |
gaagtgaaggaactttggagtcactaaaatgtgctgcttgtaactgccaccgtaacttccaccgaaaagagtcatcggcagatgttactgccggtgaccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021900 |
gaagtgaaggaactttggagtcactaaaatgtgctgcttgtaactgccaccgtaacttccaccgaaaagagtcatcggcagatgttactgccggtgaccc |
14021801 |
T |
|
| Q |
201 |
ttttctgttgacacaccatcatcaccatccaccacctccgccacagttcg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14021800 |
ttttctgttgacacaccatcatcaccatccaccacctccgccacaattcg |
14021751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 125 - 164
Target Start/End: Complemental strand, 2494714 - 2494675
Alignment:
| Q |
125 |
taaaatgtgctgcttgtaactgccaccgtaacttccaccg |
164 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2494714 |
taaaatgtgctgcttgtggctgccaccgtaacttccaccg |
2494675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University