View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_79 (Length: 242)
Name: NF11932_low_79
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 42335071 - 42334863
Alignment:
| Q |
20 |
aaaaggtggttacgaacgatggtgtttgttgttttcttaagatccattttttacgacacgtgtcataacaaggagaagcaagaacggttagttactctac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42335071 |
aaaaggtggttacgaacgatggtgtttgttgttttcttaagatccattttttacgacacgtgtcataacatggagaagcaagaacggttagttactctac |
42334972 |
T |
|
| Q |
120 |
ttcagtcagactcaagactcgctcatgcatcatctctct---tgagtcagtccaggggtttaatagtaatttgccattgttttcttttcattttcatgta |
216 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334971 |
ttc-gtcagactcaagactcgctcatgcatcatctctcttgatgagtcagtccaggggtttaatagtaatttgccattgttttcttttcattttcatgta |
42334873 |
T |
|
| Q |
217 |
cttcgttcat |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
42334872 |
cttcgttcat |
42334863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University