View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11932_low_90 (Length: 233)

Name: NF11932_low_90
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11932_low_90
NF11932_low_90
[»] chr4 (1 HSPs)
chr4 (20-193)||(54271912-54272085)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 54271912 - 54272085
Alignment:
20 gtttcttatacgtcggtcaaatgggcttctccggtggagtttgctactggtggatatggatttggtcttcattggtgggatcagagaaaacctggtggac 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54271912 gtttcttatacgtcggtcaaatgggcttctccggtggagtttgctactggtggatatggatttggtcttcattggtgggatcagagaaaacctggtggac 54272011  T
120 cggtttctcagttcaagggtaactggtaagaaaaatgttgagcctttagttacttaattgtcgagccttgactt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54272012 cggtttctcagttcaagggtaactggtaagaaaaatgttgagcctttagttacttaattgtcgagccttgactt 54272085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University