View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_93 (Length: 229)
Name: NF11932_low_93
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_93 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 25314056 - 25313822
Alignment:
| Q |
1 |
agcttagcattgattaggataactggtctgtgttcggcagcagtggtcattgcctttaaatcctgtatatccaacctcagaaaatattaagatatgcgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25314056 |
agcttagcattgattaggataactggtctgtgttcggcagcagtggtcattgcctttaaatcctgtatatccaacctcagaaaatattaagatatgtgaa |
25313957 |
T |
|
| Q |
101 |
gnnnnnnntagcagcttggaagtgttgtgataaa--acatcaaaatccatcaagccaaatagaaggttcagaa---gatatatctctaaaatgtgccaaa |
195 |
Q |
| |
|
| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||| |
|
|
| T |
25313956 |
gaaaacaatagcagcttggaagagttgtgataaaatacatcaaaatccatcaagccaaatagaaggttcagaagatgatatatttctaaaatgtgttaaa |
25313857 |
T |
|
| Q |
196 |
c-tccactctatccccttacatcaataatacaatt |
229 |
Q |
| |
|
| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25313856 |
cttccactctatctccttacatcaataatacaatt |
25313822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University