View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_97 (Length: 226)
Name: NF11932_low_97
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_97 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 37989734 - 37989542
Alignment:
| Q |
18 |
ggaattgggacaggtttggggaggctgatgttgcggagatcaagactagtgatacggtaggttcggttgtagttgtcacaatcaacacctagccatgtac |
117 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
37989734 |
ggaattgggacaggtttagggaggttgatgttttcgagatcaagaccggtgatacggtaggttcggttgaagttgtcacaatctacacctagccatgtac |
37989635 |
T |
|
| Q |
118 |
tgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcatctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37989634 |
tgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcatctg |
37989542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 118 - 210
Target Start/End: Complemental strand, 38013351 - 38013259
Alignment:
| Q |
118 |
tgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcatctg |
210 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
38013351 |
tgttgcagcagtctgtgtttggatcccatgaagagagttggctagggttgccaaattcttttttgatttggagtagggttcttttgtcatctg |
38013259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 37697748 - 37697804
Alignment:
| Q |
136 |
ttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagta |
192 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||| || |||||||||| |
|
|
| T |
37697748 |
ttggatcccatgaagagagtttggttgggttgccaaattcttttttgatttggagta |
37697804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 37993832 - 37993735
Alignment:
| Q |
110 |
ccatgtactgttacagcagtcgatggttggatcccatgaagagagttggctagggttgccaaattctttctttatttggagtagggttcttttgtcat |
207 |
Q |
| |
|
|||||| | ||| ||||||||| | |||| ||||||||||||||||| | | ||||||||||||| ||| || ||||| | |||||| ||||||||| |
|
|
| T |
37993832 |
ccatgttccgttgcagcagtcggtagttgaatcccatgaagagagtttggttgggttgccaaattgttttttgatttgaaagagggtttttttgtcat |
37993735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 18138386 - 18138354
Alignment:
| Q |
173 |
ttctttctttatttggagtagggttcttttgtc |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18138386 |
ttctttcttgatttggagtagggttcttttgtc |
18138354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University