View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11932_low_99 (Length: 209)
Name: NF11932_low_99
Description: NF11932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11932_low_99 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 167
Target Start/End: Complemental strand, 44186062 - 44185910
Alignment:
| Q |
15 |
tcaataaattgataatcgttgatcttgatcggacgatccataaaatacatatgttaattttagatcggacaatcttgctatttgtttattcagatcttat |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44186062 |
tcaatatattgataatcgttgatcttgatcggacgatccataaaatacatatgttaattttagatcggacaatcttgctatttgtttattcagatcttat |
44185963 |
T |
|
| Q |
115 |
ctaatagcgtctactgaatttaaatttagtgatttattgatatggttctcttt |
167 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44185962 |
ctaatagcgtctgccgaatttaaatttagtgatttattgatgtggttctcttt |
44185910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University