View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11933_high_12 (Length: 268)
Name: NF11933_high_12
Description: NF11933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11933_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 28613059 - 28613302
Alignment:
| Q |
9 |
agcaaaggtttcaaaacagatattacacatggtgagagtttgtgatgagtttggaaaccctaattctaagtggggttggttggacaggcctatggttttt |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28613059 |
agcaaaggtttcaaaacagatatgacacatggtgagagtttgtgatgagtttggaaaccctaattctaagtggggttggttggacaggcctatggttttt |
28613158 |
T |
 |
| Q |
109 |
tgaactttttgtgggttatcaaaccatgattgcaaagcttgagggacattccaattgtagttggtgagtaaaagacatgcagtagatcttgatgtggaga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28613159 |
tgaactttttgtgggttatcaaaccatgattccaaagcttgagggacattccaattgtagttggtgagtaaaagacatgcagtagatcttgatgtggaga |
28613258 |
T |
 |
| Q |
209 |
gaactgataaaatgtgattgataccattgttttgaagatgcttt |
252 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28613259 |
gaactgataaaatgtgattgatgccattgttttgaagatgcttt |
28613302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 41 - 189
Target Start/End: Original strand, 28604353 - 28604501
Alignment:
| Q |
41 |
tgagagtttgtgatgagtttggaaaccctaattctaagtggggttggttggacaggcctatggttttttgaactttttgtgggttatcaaaccatgattg |
140 |
Q |
| |
|
||||||| |||||||||| | || ||||||||||| ||||| || ||| || | |||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
28604353 |
tgagagtatgtgatgagtaggcaagccctaattctatgtgggtttcgttcgataagcctatggcatttcgaactttttgttggttatcaaaccatgattc |
28604452 |
T |
 |
| Q |
141 |
caaagcttgagggacattccaattgtagttggtgagtaaaagacatgca |
189 |
Q |
| |
|
||||||||| ||||||||||||||| | || |||||||||||||||| |
|
|
| T |
28604453 |
tgaagcttgagtgacattccaattgtaatgggagagtaaaagacatgca |
28604501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University