View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11933_low_14 (Length: 241)
Name: NF11933_low_14
Description: NF11933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11933_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 5075517 - 5075741
Alignment:
| Q |
1 |
ttgcctctttcttggtagaaataagtgttttaaaggtattaatcatttcattaagtttcgcttgatccttcaactgtttatcattgacaaaaatattgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
5075517 |
ttgcctctttcttggtagaaataagtgctttaaaggtattaatcatttcattaagtttcacttgatccttcaactgtttatcattgacaaaaacattaag |
5075616 |
T |
|
| Q |
101 |
aaacatcaacgatgaacaactgaaggaagatgtaaagtttcatgaaacgatttatgaatgtaattcacttatttctgcaaagaagaagatactgaacgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5075617 |
aaacatcaacgatgaacaactgaaggaagatgtaaagtttcatgaaacgatttatggatgtaattcacttatttctgcaaagaagaagataccgaacgcc |
5075716 |
T |
|
| Q |
201 |
aagaaagatgttgcctgaagtaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5075717 |
aagaaagatgttgcctgaagtaaat |
5075741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University