View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11933_low_6 (Length: 372)
Name: NF11933_low_6
Description: NF11933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11933_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 24 - 354
Target Start/End: Original strand, 5548914 - 5549243
Alignment:
| Q |
24 |
tacaaacacaccgcaaatgaatcaattatagcatttgcaaaattacgcaacaaagtgcacaaataataagcatatttactttgctatccatggctagcaa |
123 |
Q |
| |
|
||||||| || ||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
5548914 |
tacaaacccaacgcaaattaatcaattatagcatttgcaaaat-acgcaacaaagtgcacaaatagtaagcatatttacattgctatccatggctagcaa |
5549012 |
T |
 |
| Q |
124 |
agaattcaggttggtttcaccagcaattgacaaagaaggaggtgtcaaattaccaagatattacacacatgaaggtgtaggttcaaagtggaacatatct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
5549013 |
agaattcaggttggtttcaccagcaattgacaaagaaggaggtgtcaaattaccaagatattacacacatgaaggcgtaggttcaaagtggaatatatct |
5549112 |
T |
 |
| Q |
224 |
ccacctctagaatggcataacgttcctcccaaaaccaagagcctagctcttgtggtgcaggatgttgacaccctggatccaactggacgcacggtgccaa |
323 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5549113 |
ccacctctagaatggcttaacgttcctcccaaaaccaagagcctagctcttttggtgcaggatgttgacaccgtggatccaactggacgcacggtgccaa |
5549212 |
T |
 |
| Q |
324 |
tcacccattggatagtggtcaatattccggc |
354 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
5549213 |
tcacccattgggtagtggtcaatattccggc |
5549243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University