View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11934_low_5 (Length: 244)
Name: NF11934_low_5
Description: NF11934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11934_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 39 - 223
Target Start/End: Original strand, 14744977 - 14745166
Alignment:
| Q |
39 |
ggcaagaatgacgaatataatgatagctggaatgcacttgggcaaaaacaa-gatgagtggtaaggggagatgatcagaaacgacgacaa----gagtta |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
14744977 |
ggcaagaatgacgaatataatgatagctggaatgcacttgggcaaaaacaatgatgagtggtaaggggagatgatcagaaacgacgacaacaacgagtga |
14745076 |
T |
 |
| Q |
134 |
aggtaaagatgagttaagaaggcattgagtgaccaagaagaagaataaagacgtaaggtttctttttggctgtgttttgagagagaataa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14745077 |
aggtaaagatgagttaagaaggcattgagtgaccaagaagaagaataaagacgtaagggttctttttggctgtgttttgagagagaataa |
14745166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University