View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11935_high_10 (Length: 289)
Name: NF11935_high_10
Description: NF11935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11935_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 34421136 - 34420980
Alignment:
| Q |
1 |
tagctgtgaatagttaatagactatcatgagaatagataatgtattcataattttctctaataaggtgagaacatagatagataaagaataaagaaaaga |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34421136 |
tagctgtgaatagtttatagactatcatgagaataaataatgtattcataattttctctaataaggtgagaacatagatatataaagaataaagaaaaga |
34421037 |
T |
 |
| Q |
101 |
aaaagatgatgagccatgcgacaggcgtgactgacatgtacaactttgctatatacc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34421036 |
aaaagatgatgagccatgcgacaggcgtgactgacatgtacaactttgctatatacc |
34420980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 273
Target Start/End: Complemental strand, 34420899 - 34420864
Alignment:
| Q |
238 |
attctctccacacagtccatttctagaaaatctttt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34420899 |
attctctccacacagtccatttctagaaaatctttt |
34420864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University