View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11935_high_12 (Length: 239)
Name: NF11935_high_12
Description: NF11935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11935_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1712313 - 1712086
Alignment:
| Q |
1 |
cttttggaataacataaagaactataaccctattattctctaaagatatgtatattgagattggttccaaatttatttttgtttgcattgatcacatgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1712313 |
cttttggaataacataaagaactataaccctattattctctaaagatatgtatattgagattggttccaaatttatttttgcttgcattgatcacatgat |
1712214 |
T |
|
| Q |
101 |
catatctaaaaccagacaatgatggacttatatccaaattgggtactgtttataaacatttgaaattatgagaatc-----atatatgtatttccatgga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
1712213 |
catatctaaaaccagacaatgatggacttatatccaaattgggtactgtttataaacatttgaaattaggagaatcatatcatatatgtatttccatgga |
1712114 |
T |
|
| Q |
196 |
atgaatgttattgaaattaagttgatac |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1712113 |
atgaatgttattgaaattaagttgatac |
1712086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University