View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11935_high_17 (Length: 201)
Name: NF11935_high_17
Description: NF11935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11935_high_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 25 - 201
Target Start/End: Complemental strand, 1712595 - 1712411
Alignment:
| Q |
25 |
caagttagttgaataatgaatttataa--------gttaaaaaggtttgaaactaatttttattttgagacaagttttatctcaacttcaaattaaaacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1712595 |
caagttagttgaataatgaatttataaaaacagttgttaaaaaggtttgaaactaatttttattttgagacaagttttatctcaacttcaaattaaaacc |
1712496 |
T |
 |
| Q |
117 |
tactatttagacaaaaacaattatcttcaaaagcatccaaaataacatgtcaacatcaattttataatcctagaatcacttttac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1712495 |
tactatttagacaaaaacaattatcttcaaaagcatccaaaataacatgtcaacatcaattttataatcctagaatcacttttac |
1712411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University