View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11936_high_12 (Length: 237)
Name: NF11936_high_12
Description: NF11936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11936_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 2305556 - 2305774
Alignment:
| Q |
1 |
atttaagctattcttattggatactcatcaaatatttttcatttgtcgaatatggatggattgtctcatgaggctgcagttaaaggagggcaatgcttag |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2305556 |
atttaagctattctcattggatactcatcaaatatttttcatttgtcgaatatgg----attgtctcatgaggctgcagttaaaggagggcaatgcttag |
2305651 |
T |
 |
| Q |
101 |
tttcttgaaagagatgcatgtgatccgatttaatttgatagtctttatcttcttcattttcagcatcccaaaggaatttggcatatgaagctaggacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2305652 |
tttcttgaaagagatgcatgtgatccgatttaatttgatagtctttatcttcttcattttcagcatcccaaaggaatttggcatatgaagctaggacata |
2305751 |
T |
 |
| Q |
201 |
gctgcataatattaagtaaatat |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2305752 |
actgcataatattaagtaaatat |
2305774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 204
Target Start/End: Complemental strand, 44694294 - 44694230
Alignment:
| Q |
140 |
agtctttatcttcttcattttcagcatcccaaaggaatttggcatatgaagctaggacatagctg |
204 |
Q |
| |
|
|||| |||||||| || | |||||||||||| |||||||| ||||||||||| | |||||||||| |
|
|
| T |
44694294 |
agtcattatcttcatcttcttcagcatcccataggaattttgcatatgaagccaagacatagctg |
44694230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University