View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11936_high_9 (Length: 268)
Name: NF11936_high_9
Description: NF11936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11936_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 258
Target Start/End: Complemental strand, 2305403 - 2305155
Alignment:
| Q |
10 |
tcccctaattttttgttcatactttcaaatcatttaaaaactaattaagatttgaaataggcaagatcgttgatcggttatagtgtcaacatagttggta |
109 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2305403 |
tcccctaattttttgttcatgctttcgaatcatttaaaaactaattaagatttgaaataggcaagatcgttgatcggttatagtgtcaacataattggta |
2305304 |
T |
|
| Q |
110 |
tgttagttaacaaagcgatacttttgcacactttttgttgctaaaaatagttggatccctcaacaggtgcttggatccgtaaggagttcgatcatgttgt |
209 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
2305303 |
tgttagttaacaaagtgatacttttgcacactttttgttgctaaaaatagttggatccctcaacatgtgcttggatcggtaaggagttcgatcatgttgt |
2305204 |
T |
|
| Q |
210 |
gccgcaacatgttcgttggacatatatgttgcttctttagtggcctttg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2305203 |
gccgcaacatgttcgttggacatatatgttgcttctttagtggcctttg |
2305155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University