View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11937_high_3 (Length: 260)
Name: NF11937_high_3
Description: NF11937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11937_high_3 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 10484846 - 10484617
Alignment:
| Q |
17 |
aatgtttatagtggatacccttttgattcattatatgttttgctacttgaggtatccactatcaccagaacctccaccatcatttgtcctattgaccctg |
116 |
Q |
| |
|
||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10484846 |
aatgtttttagtggatactcttttgatt----atatgttttgctacttgaggtatccactatcaccagaacctccaccatcatttgtcctattgaccctg |
10484751 |
T |
|
| Q |
117 |
tagttactatgttcaacaatggacaccctttttctgatgttctttcaaaaatatgatacattgttttactattgcacgtgcatcactcccttgggcctac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10484750 |
tagttactatgttcaacaatggacaccctttttctgatgttctttcaaaaatatgatacattgttttactattgcacgtgcatcactcccttgggcctac |
10484651 |
T |
|
| Q |
217 |
aaaagacaaaagtttctatatgcggctacttcat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10484650 |
aaaagacaaaagtttctatatgcggctacttcat |
10484617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 4951029 - 4951235
Alignment:
| Q |
1 |
aaaaaacctcgtccacaatgtttatagtggatacccttttgattcattatatgttttgctacttgaggtatccact------atcaccagaacctccacc |
94 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4951029 |
aaaaaacctcgtccacaatgtttttagtggatacccttttgattcattatatgttttgctacttgaggtatccactatcactatcaccagaacctccacc |
4951128 |
T |
|
| Q |
95 |
atcatttgtcctattgaccct---gtagttactatgttcaacaatggacaccctttttctgatgttctttcaaaa-atatgatacattgttttactattg |
190 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||| | ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4951129 |
atcatttgtcatattggccctgtagtagttactcttttcaacaatggacaccctttt--ggatgttctttcaaaacatatgatacattgttttactattg |
4951226 |
T |
|
| Q |
191 |
cacgtgcat |
199 |
Q |
| |
|
||||||||| |
|
|
| T |
4951227 |
cacgtgcat |
4951235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 223832 - 223735
Alignment:
| Q |
1 |
aaaaaacctcgtccacaatgtttatagtggatacccttttgattcattatatgttttgctacttgaggtatccactatcaccagaacctccaccatcatt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
223832 |
aaaaaacctcgtccacaatgtttttagtggatacacttttgattg----tatgttttgctacttgaggtatccactatcaccaaaacctccaccatcatt |
223737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University