View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11938_high_24 (Length: 311)
Name: NF11938_high_24
Description: NF11938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11938_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 42678090 - 42678391
Alignment:
| Q |
1 |
ttaattaagttatgcttgtgcgttttaaattcaccacattaaccccctcttttacacatgctgctgctagttgtataatgtttaaatattgctgagagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42678090 |
ttaattaagttatgcttgtgcgttgtaaattcaccacattaaccccctcttttacacatgctgctgctagttgtttaatgtttaaatattgctgagagaa |
42678189 |
T |
|
| Q |
101 |
nnnnnnnnattgggtggttaacattctttctcatcgtttcttgctcagaatttcaacttgtacctgattcaagaccacaatgataatgatgaaggaagag |
200 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42678190 |
ttttttttattggtttgttaacattctttctcatcgtttcttgctcagaatttcaacttgtacctgattcaagaccacaatgataatgatgaaggaagac |
42678289 |
T |
|
| Q |
201 |
cctagttcaaaaccaatcatgatccgtaaagtgtggggatacaatttgtcttgcgaattcaagctcattagtcagttaattggtaaatacaatttcatct |
300 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42678290 |
cctggttcaaaaccaatcatgatccgtaaagtgtggggatacaatttgtcttgcgaattcaagctcattagtcagttaattggtaaatacaatttcatct |
42678389 |
T |
|
| Q |
301 |
ca |
302 |
Q |
| |
|
|| |
|
|
| T |
42678390 |
ca |
42678391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University