View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11938_high_29 (Length: 249)

Name: NF11938_high_29
Description: NF11938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11938_high_29
NF11938_high_29
[»] chr2 (1 HSPs)
chr2 (18-249)||(18708070-18708289)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 18708070 - 18708289
Alignment:
18 gattcaaatcaacctcacaacaaatatatttattactcttgatttgcctatacaaattcgctagtttgctcatcaaaatggctttgctcaacacttattt 117  Q
    |||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
18708070 gattcaaatcaacctcacaacaaatat------tactcttgatttgcctatacaaattcgctagtttgctcatcaaaatggctttgcttaacacttattt 18708163  T
118 tttt--ctagnnnnnnnnnnnnnnngcattgtttactagtttcataaacttgtaatttaatttagttatatataacaactaccaccattacataatcatt 215  Q
    ||||  ||||                |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||| ||||||||||    
18708164 ttttttctagaaaaaaaagaa-----cattgtttactagtttcataaacttgtaatttaatttagtttcatataacaactaccaccattgcataatcatt 18708258  T
216 aaaattcacattatacttcttctcttttacatat 249  Q
    |||||||||||||||||||   ||||||||||||    
18708259 aaaattcacattatacttc---tcttttacatat 18708289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University