View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11938_low_30 (Length: 249)
Name: NF11938_low_30
Description: NF11938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11938_low_30 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 18708070 - 18708289
Alignment:
| Q |
18 |
gattcaaatcaacctcacaacaaatatatttattactcttgatttgcctatacaaattcgctagtttgctcatcaaaatggctttgctcaacacttattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18708070 |
gattcaaatcaacctcacaacaaatat------tactcttgatttgcctatacaaattcgctagtttgctcatcaaaatggctttgcttaacacttattt |
18708163 |
T |
|
| Q |
118 |
tttt--ctagnnnnnnnnnnnnnnngcattgtttactagtttcataaacttgtaatttaatttagttatatataacaactaccaccattacataatcatt |
215 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
18708164 |
ttttttctagaaaaaaaagaa-----cattgtttactagtttcataaacttgtaatttaatttagtttcatataacaactaccaccattgcataatcatt |
18708258 |
T |
|
| Q |
216 |
aaaattcacattatacttcttctcttttacatat |
249 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
18708259 |
aaaattcacattatacttc---tcttttacatat |
18708289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University