View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11938_low_33 (Length: 229)
Name: NF11938_low_33
Description: NF11938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11938_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 36331173 - 36331315
Alignment:
| Q |
18 |
atatagccccacca-aaaagaaccaataagaaaattcaggcggttacaagagagatagaagagtggagtaggagtcaatgattctagtgggttcctgtaa |
116 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331173 |
atatagccccacaacaaaagaaccaataagaaaattcaggcggttacaagagagatagaagagtggagtaggagtcaatgattctagtgggttcctgtaa |
36331272 |
T |
 |
| Q |
117 |
taggccccacctgttcaattttataataaataagaaaaaacaa |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331273 |
taggccccacctgttcaattttataataaataagaaaaaacaa |
36331315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University