View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11939_high_11 (Length: 298)
Name: NF11939_high_11
Description: NF11939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11939_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 49298253 - 49297973
Alignment:
| Q |
1 |
ccgcccaaaacagggaagttttgcacggaataaggaagaaattcaatgtcttggtatatctctataaacggcaacggcaatccatgtgattannnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49298253 |
ccgcccaaaacagggaagttttgcacggaataaggaagaaattcaatgtcttggtatatctctataaacggcaacggcaatccatgtgattatttttttt |
49298154 |
T |
|
| Q |
101 |
-cttaattattacttttaagttttagcttctttaataaaacaaactcatatcttttgtttccagatttgttaatgaagaaaggccggaacactaggtgtc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49298153 |
tcttaattattacttttaagttttagcttctttaataaaacacactcatatcttttgtttcctgatttgttaatgaagaaaggccggaacactaggtgtc |
49298054 |
T |
|
| Q |
200 |
atctagaaggaacatttggcaccgtatgtgggaagagaaagaatcttcccactaatttctcatcatttgagaacatatgat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
49298053 |
atctagaaggaacatttggcaccgtatgtgggaagagaaagaatcttctcactgatttctcatcatttgagaacatatgat |
49297973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University