View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11939_high_15 (Length: 222)
Name: NF11939_high_15
Description: NF11939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11939_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 9258557 - 9258371
Alignment:
| Q |
22 |
gtatgcaaatgcgtgtgttgctgattccgtgattaaggattttgtgagaatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9258557 |
gtatgcaaatgcgtgtgttgctgattccgtgattaaggattttgtgagaatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtg |
9258458 |
T |
|
| Q |
122 |
tcattggagttttgtgaattgcttagaagggcacggtgtaagtacgatgatcctctgtatgttttttgccgggatagtttttcatct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9258457 |
tcattggagttttgtgaattgcttagaagggcacggtgtaagtatgatgatcctctgtatgttttttgccgggatagtttttcatct |
9258371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 9268564 - 9268379
Alignment:
| Q |
23 |
tatgcaaatgcgtgtgttgctgattccgtgattaaggattttgtgagaatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtgt |
122 |
Q |
| |
|
|||||||||| | || ||||| |||| ||||||||||||||||||| |||||| ||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9268564 |
tatgcaaatgggcgtattgcttattctgtgattaaggattttgtgaaaatttgcttaaattcgaaggacaaaaagttgcagggtgtttaccttgaagtgt |
9268465 |
T |
|
| Q |
123 |
cattggagttttgtgaattgcttagaagggcacggtgtaagtacgatgatcctctgtatgttttttgccgggatagtttttcatct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
9268464 |
tattggagttttgtgaattgcttagaaggacagggtgtaagtccgatgatcgtctgtatgttttttgccgggatagttttgcatct |
9268379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 72 - 202
Target Start/End: Complemental strand, 9250436 - 9250306
Alignment:
| Q |
72 |
tttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtgtcattggagttttgtgaattgcttagaagggcacggtgtaagtacgatga |
171 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| ||| |||||| ||||||| |||||||||||||||||||||||| ||| | ||||||||| ||| | |
|
|
| T |
9250436 |
tttgtttagatttgaagtgcaaaacgttgcagagtgcttacctagaagtgttgttggagttttgtgaattgcttagaggggtagggtgtaagtgtgatca |
9250337 |
T |
|
| Q |
172 |
tcctctgtatgttttttgccgggatagtttt |
202 |
Q |
| |
|
|||| ||||||||| ||| |||||| ||||| |
|
|
| T |
9250336 |
tcctttgtatgtttgttgtcgggatggtttt |
9250306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 70 - 202
Target Start/End: Complemental strand, 9237914 - 9237782
Alignment:
| Q |
70 |
aatttgtttagatttgaaggacaaaaagttgcagggtgtttaccttgaagtgtcattggagttttgtgaattgcttagaagggcacggtgtaagtacgat |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| | ||||||||| | | ||||| |||||||||||||||||| ||| | | | || || ||| |
|
|
| T |
9237914 |
aatttgtttagatttgaagtgcaaaaagttgcagggtttctaccttgaaattttgttggatttttgtgaattgcttagaggggtaggttttacgtgtgat |
9237815 |
T |
|
| Q |
170 |
gatcctctgtatgttttttgccgggatagtttt |
202 |
Q |
| |
|
|| ||| ||||||||| ||| |||||| ||||| |
|
|
| T |
9237814 |
gagcctttgtatgtttcttgtcgggatggtttt |
9237782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University