View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11939_low_14 (Length: 273)
Name: NF11939_low_14
Description: NF11939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11939_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 21 - 255
Target Start/End: Complemental strand, 11379394 - 11379154
Alignment:
| Q |
21 |
cagagcaaaaaggagaaagataaagaagcttcaaacacaaccaacttttttactagagtgaagaatttggagatggtgtaaaattacatgaactagtgtg |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379394 |
cagagcaaacaggagaaagataaagaagcttcaaacacaaccaacttttttactagagtgaagaatttggagatggtgtaaaattacatgaactagtgtg |
11379295 |
T |
|
| Q |
121 |
catgtg------aatataattatgttttgataatttacaaggcaaaaagaaaaatatagatcaaggcaatccaagtcttgtattatgagtttatttacta |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379294 |
catgtgcatgtgaatataattatgttttgataatttacaaggcaaaaagaaaaatatagatcaaggcaatccaagtcttgtattatgagtttatttactt |
11379195 |
T |
|
| Q |
215 |
gaaattcagatgttttaggatatttatgtgagtaatgtaaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379194 |
gaaattcagatgttttaggatatttatgtgagtaatgtaaa |
11379154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University