View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11939_low_15 (Length: 271)
Name: NF11939_low_15
Description: NF11939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11939_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 10 - 255
Target Start/End: Complemental strand, 39553531 - 39553285
Alignment:
| Q |
10 |
atgatcttgacatttaagctcgctggtatggttggtgtcatgtgtatcattgtcaaaatgagtttcggaatatcacatgatgtataaaccctagaaaatt |
109 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39553531 |
atgatcttgacatttaagcccgctgatatggttggtgtcatgtgtatcattgtcaaaatgagtgtcggaatatcacatgatgtataaaccctagaaaatt |
39553432 |
T |
|
| Q |
110 |
ataaaacaataattaataatattattacatccacttttacttacatttataacacctaa-taatcatatttaaaaatattgttaatattgttgaatagat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39553431 |
ataaaacaataattaataatattattacatccacttttacttacatttgtaacacctaattaatcatgtttaaaaatattgttaatattgttgaatagat |
39553332 |
T |
|
| Q |
209 |
ggttagttcaatttacgatcgaataagtggtttattcacatagaaag |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39553331 |
ggttagttcaatttacgatcgaataagtggtttattcacataaaaag |
39553285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University