View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11939_low_17 (Length: 241)
Name: NF11939_low_17
Description: NF11939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11939_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 48068535 - 48068754
Alignment:
| Q |
1 |
ttgaggtcttgacatttgcaagttatagaatggaatgattgnnnnnnnnnnnccaatctatacaaaccaatataattcatttattataaatactctcttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48068535 |
ttgaggtcttgacatttgcaagttatagaatggaatgattgtttttttt---ccaatctatacaaaccaatataattcatttattataaatactctcttg |
48068631 |
T |
|
| Q |
101 |
gtcccaaattgtaagcgaaatgagtcaaacaatattgatatatttgatttgaaattttgaacccgatatgtactagtaccttgtgattgtttgactcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48068632 |
gtcccaaattgtaagcgaaatgagtcaaacaatattgatatatttgatttgaaattttaaacccgatatgtactagtaccttgtgattgtttgactcttc |
48068731 |
T |
|
| Q |
201 |
aaaaaacaaacttcactatcctt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48068732 |
aaaaaacaaacttcactatcctt |
48068754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University