View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1193_high_13 (Length: 308)
Name: NF1193_high_13
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1193_high_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 52809689 - 52809878
Alignment:
| Q |
1 |
aattatatttctcagccttgcaatctctgtcatacctgatgcaaccattgacaacattgcaattattaacccaattcccattctttcaagttcactaatt |
100 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52809689 |
aattatatttctcagccttaccatctctgtcatacctgatgcaaccattgacaacattgcaattattaacccaattcccattctttcaagttcactaatt |
52809788 |
T |
 |
| Q |
101 |
ccccttgtattaccaatcaatcttcctactaacggaacaaggattgtgcgatatattacagtgcatactagcacactacagatgtcaaac |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52809789 |
ccccttgtattaccaatcaatcttcctactaacggaacaaggattgtgcgatatattacagtgcatactagcacactacagatgtcaaac |
52809878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 183 - 308
Target Start/End: Original strand, 40338630 - 40338754
Alignment:
| Q |
183 |
tgtcaaaccttcttccctcgtttcttcagttatgtattttgtcctataatacttaaaccctcaaaaatccgaatattgctacattgtgtcattttttatt |
282 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40338630 |
tgtccaaccttcttacctcgtttcttcagttatgtattt-gtcctataatacttaaaccctcaaaaatccaaatattgctacattgtgtcattttttatt |
40338728 |
T |
 |
| Q |
283 |
tggatattctgtataatttagatatt |
308 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40338729 |
tggatattctgtataatttagatatt |
40338754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University