View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1193_high_25 (Length: 202)
Name: NF1193_high_25
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1193_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 31386165 - 31386065
Alignment:
| Q |
1 |
attgtcaaatcatgattatagctaggtggaatttgaacaaataatagttaatgttttgtgatagttatttagttcaaagtgttgtcaaataacagctata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31386165 |
attgtcaaatcatgattatagctaggtggaatttgaacaaata---gttaatgttttgtgatagttatttagttcaaagtgttgtcaaataacagctata |
31386069 |
T |
|
| Q |
101 |
gaac |
104 |
Q |
| |
|
|||| |
|
|
| T |
31386068 |
gaac |
31386065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 52 - 102
Target Start/End: Original strand, 14399834 - 14399884
Alignment:
| Q |
52 |
tgttttgtgatagttatttagttcaaagtgttgtcaaataacagctataga |
102 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14399834 |
tgttttgtgatagctatttagtacaaagtgttgtcaaatagcagctataga |
14399884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 101
Target Start/End: Original strand, 5048525 - 5048561
Alignment:
| Q |
65 |
ttatttagttcaaagtgttgtcaaataacagctatag |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
5048525 |
ttatttagtacaaagtgttgtcaaataacagttatag |
5048561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 67 - 100
Target Start/End: Complemental strand, 31235242 - 31235209
Alignment:
| Q |
67 |
atttagttcaaagtgttgtcaaataacagctata |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
31235242 |
atttagttcaaagtgttgtcaaatagcagctata |
31235209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University