View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1193_low_22 (Length: 270)
Name: NF1193_low_22
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1193_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 9811937 - 9811676
Alignment:
| Q |
1 |
ctgtctccctcactgcattggtatcttctcgtaaccgcactttgtcttgaatggctcaagtcttgtaatttttagagtttaacaaattataacatggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9811937 |
ctgtctccctcactgcattggtatcttctcgtaaccgcactttgtcttgaatggttcaagtcttgtaatttttagagtttaacaaattataacaaggatt |
9811838 |
T |
 |
| Q |
101 |
tgttgcattttattagcttcttatttgtttaaagggacatggcattgtcttcaattatgctaaacaagtttttgtttggcagaccggtgttacaaatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9811837 |
tgttgcattttattagcttcttatttgtttaaagggacatggcattgtcttcaattatgctaaacaagtttttgtttggcagaccggtgttacaaatgct |
9811738 |
T |
 |
| Q |
201 |
ggtgattataattcaacaagttcctcttaattaaagtacaatcactagcaaccatatacttc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||| |
|
|
| T |
9811737 |
ggtgattataattcaacaagttcctcttaataaaagtacaatcacttgcaaccatatgcttc |
9811676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 21 - 156
Target Start/End: Original strand, 14155763 - 14155911
Alignment:
| Q |
21 |
gtatcttctcgtaaccgcactttgtcttgaatggctcaagtcttgtaatttttagagtttaacaaattataacatg--------------gatttgttgc |
106 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||| || ||||||||||||||| ||||||||||||||||| |||| |||||||||| |
|
|
| T |
14155763 |
gtatcttcttgcgaccacactttgtcttgaatggttcgagtcttgtaattttt-gagtttaacaaattatagcatgttctttttgatttagatttgttgc |
14155861 |
T |
 |
| Q |
107 |
attttattagcttcttatttgtttaaagggacatggcattgtcttcaatt |
156 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| | || ||||||||| |
|
|
| T |
14155862 |
attttattagtttcttatttgtttaaagggacatgccgttatcttcaatt |
14155911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University