View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1193_low_23 (Length: 268)
Name: NF1193_low_23
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1193_low_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 29 - 268
Target Start/End: Original strand, 17268992 - 17269231
Alignment:
| Q |
29 |
agaggtttagtctcattcattgatggtagcaacacattacatctctcttctattcccaacttcattttggtataaacatttccatcatacggatgttatg |
128 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
17268992 |
agaggtttagtctcattcattgatggtggcaacacattacatctctcttctattcccaacttcattttggtatgaacatttccatcatacggatgttgtg |
17269091 |
T |
|
| Q |
129 |
gacctacatgcacaacaagatgtaaatttcttttggcgtatatagagagaaaaaacaaatactaatttacaaattatttttcaacattttttgaagagat |
228 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17269092 |
gacctacatgcacaacaacatgtaaatttcttttggcgtatatagagagaaaaaacaaaaactaatttacaaattatttttcaacattttttgaagagat |
17269191 |
T |
|
| Q |
229 |
atatgaaatattttctttaggtataataacctaactatca |
268 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17269192 |
atgagaaatattttctttaggtataataacctaactatca |
17269231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University