View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1193_low_24 (Length: 267)
Name: NF1193_low_24
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1193_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 47 - 240
Target Start/End: Complemental strand, 33079570 - 33079377
Alignment:
| Q |
47 |
atttggagaacaaaaatagaaaattggcggatgaaaagcgcaaagttgagaccttgcttgagtttttgaacacgaagttcaaagtattgcatggaagtgt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33079570 |
atttggagaacaaaaatagaaaattggcggatgaaaagcgcaaagttgagacctcacttgagtttttgaacacgaagttcaaagtattgcatgaaagtgt |
33079471 |
T |
|
| Q |
147 |
tgcacggttggaggaggattccaaacttttggtgagcttagctgcctctggtcgaggaaacaatgacggtgagcctcctgctgctgaacctatg |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33079470 |
tgcacggttggaggatgattccaaacttttggtgaacttagctgcctctggtcgaggaaacaatgacggggagcctcctgctgctgaacctatg |
33079377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 93 - 212
Target Start/End: Complemental strand, 41519251 - 41519132
Alignment:
| Q |
93 |
tgagaccttgcttgagtttttgaacacgaagttcaaagtattgcatggaagtgttgcacggttggaggaggattccaaacttttggtgagcttagctgcc |
192 |
Q |
| |
|
||||| ||| || |||| |||||||| ||||| |||| ||| |||| ||| |||||| |||||||||| |||||||| |||| |||| ||| |||| |
|
|
| T |
41519251 |
tgagatcttactcgagtctttgaacaaaaagtttaaagcatttcatgaaagagttgcaaggttggaggatgattccaacctttcaatgagtgtagatgcc |
41519152 |
T |
|
| Q |
193 |
tctggtcgaggaaacaatga |
212 |
Q |
| |
|
|||||| | ||||||||||| |
|
|
| T |
41519151 |
tctggtggtggaaacaatga |
41519132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University