View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1193_low_27 (Length: 257)
Name: NF1193_low_27
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1193_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 21298691 - 21298792
Alignment:
| Q |
30 |
aaccccacaaccaatcgtactactactaccccacaaataccacgatgcagctttggggataatatgatgactagcagtaaaaccatgtaatcataactac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21298691 |
aaccccacaaccaatcgtactactactaccccacaaataccacgatgcagctttggggataatatgatgactagcagtaaaaccatgtaatcataactac |
21298790 |
T |
|
| Q |
130 |
cc |
131 |
Q |
| |
|
|| |
|
|
| T |
21298791 |
cc |
21298792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 196 - 257
Target Start/End: Original strand, 21298857 - 21298918
Alignment:
| Q |
196 |
gcaaggctatt-atagtcacaccaccatcctaaactgtaactataattaatcgatacgtgtaa |
257 |
Q |
| |
|
||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
21298857 |
gcaaggctatttatagtcacaccaccatc-tagactgtaactataattaatcgatacgtgtaa |
21298918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University