View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1193_low_28 (Length: 252)
Name: NF1193_low_28
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1193_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 21299075 - 21299312
Alignment:
| Q |
1 |
tgaaaaactaatgcattaggtgtttgacacaattcagattatgtaatcagcatcatgtcatatatatggtttttctttggtctacattgcatagataatt |
100 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||| |||||||||||||||||| |||||||| ||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
21299075 |
tgaaaaactaatgtattgggtgtttgatgcaattcaaattatgtaatcagcatcaggtcatatacatgatttttctttggcctacattgcactgataatt |
21299174 |
T |
 |
| Q |
101 |
tcaacaccgctatgaattagaatgtttggttgattttcaatccacaccacaaaaccatgacaacttatacaaaatataaatgaacattaagctagttgca |
200 |
Q |
| |
|
||||||| |||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21299175 |
tcaacactgctatgaattggaatgttcggttgattttcaatccacaccacaaatccatgacaacttatacaaaatataaatgaacattaagctagttgca |
21299274 |
T |
 |
| Q |
201 |
atgtactacaacaaggggggccaaatctgtttagggtc |
238 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
21299275 |
atgtactacaacaagggggaccaaatctatttagggtc |
21299312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University