View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1193_low_37 (Length: 215)

Name: NF1193_low_37
Description: NF1193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1193_low_37
NF1193_low_37
[»] chr6 (1 HSPs)
chr6 (12-119)||(17443555-17443663)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 12 - 119
Target Start/End: Original strand, 17443555 - 17443663
Alignment:
12 tgtgtagttcataatttattcatgatgttgggtgagagtagctctccatgtttggccttatttc-tttctagtttcacgaca-tttttgttattatccaa 109  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||| |||||||||||    
17443555 tgtgtagttcataatttattcatgttgttgggtgagagtagctctccatgtttggcc-tatttcttttctagtttcacgacatttttttttattatccaa 17443653  T
110 atgtacttat 119  Q
    ||||||||||    
17443654 atgtacttat 17443663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University