View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11940_high_45 (Length: 242)
Name: NF11940_high_45
Description: NF11940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11940_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 9763964 - 9764195
Alignment:
| Q |
1 |
cacttcaacattatcagactcttttactagctcagagtatatgatctgtcttggtatattggtctttacttnnnnnnntttccatgctcttgcagactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||| ||||| | |
|
|
| T |
9763964 |
cacttcaacattatcagactcttttactagctcagagtatataatttgtcttggtatattggtctttacttaaaaaa-tttccatgctcttgtagacttt |
9764062 |
T |
 |
| Q |
101 |
gaaaaccttttcttgagtgcttcttgctgagaagcaattgcaatggtttgaagattgtccaatgtattgtcaacaagctttctcagactattccatttat |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
9764063 |
gaaaaccttttcttgagtacttcttgctgagaagccattgcaatggtttgaagattgtccaatgtattgtccacaagctttctcagactattccatgtat |
9764162 |
T |
 |
| Q |
201 |
caatatagttgagaagatgtatagcttgatgtc |
233 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
9764163 |
caatatagttgagaagatgtatggcttgatgtc |
9764195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 233
Target Start/End: Complemental strand, 24493876 - 24493762
Alignment:
| Q |
119 |
gcttcttgctgagaagcaattgcaatggtttgaagattgtccaatgtattgtcaacaagctttctcagactattccatttatcaatatagttgagaagat |
218 |
Q |
| |
|
||||||||||| ||||||||| | ||||| | |||||||||||| || | || | ||||||| ||| || |||||||| || |||||||| ||||| |
|
|
| T |
24493876 |
gcttcttgctgtgaagcaatttccatggtataaagattgtccaacgtgtagtgcataagctttttcaatctgttccatttgtcggcatagttgacaagat |
24493777 |
T |
 |
| Q |
219 |
gtatagcttgatgtc |
233 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
24493776 |
gtattgcttgatgtc |
24493762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University