View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11940_low_10 (Length: 592)
Name: NF11940_low_10
Description: NF11940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11940_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 213 - 582
Target Start/End: Original strand, 27069861 - 27070235
Alignment:
| Q |
213 |
ttgatatgttgttaacaaatttagagaaaatcaacaagggctgcaagcgattttagcatagttatgcggcggtattccttttggcgaggtggtgcggttg |
312 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27069861 |
ttgatctgttgttaacagatttagagaaaatcaacaagggctgcaagcgattttagcataattatgcggcggtattccttttggcgaggtggtgcggttg |
27069960 |
T |
 |
| Q |
313 |
gattctctggctgctggttttttggttttgtgttgaagtttgttgttagccagttttaggtgcagaaggtggagtttcactatgacgttgaggtattctt |
412 |
Q |
| |
|
||| || |||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27069961 |
gatcgtccggctgctggttttttggttttgtgttgaggtttgttgctagccggttttaggtgcagaaggtggagtttcactatgacgttggggtattctt |
27070060 |
T |
 |
| Q |
413 |
atttttggtttcggttttagctagaagtttgttgtttcgctgtttggctcaagcaagt-----gtgtggatgttttaaattatcttggaatatgttaatt |
507 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| ||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27070061 |
atttttggtttcggtttcagctagaagcttgctgttttgctgtttggctcaagcaagtgtgtggtgtggatgttttaaattatgttggaatatgttaatt |
27070160 |
T |
 |
| Q |
508 |
agtaacatgttagatgggataggttgtttagtgctagctggtatgcttttttagttaggatgtgttgttgcttct |
582 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
27070161 |
agcaacatgttagatgggatgggttgtttagtgctagctggtgtgcttttgtagttaggatgtgttgttgcttct |
27070235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 213 - 582
Target Start/End: Original strand, 27149947 - 27150321
Alignment:
| Q |
213 |
ttgatatgttgttaacaaatttagagaaaatcaacaagggctgcaagcgattttagcatagttatgcggcggtattccttttggcgaggtggtgcggttg |
312 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27149947 |
ttgatctgttgttaacagatttagagaaaatcaacaagggctgcaagcgattttagcataattatgcggcggtattccttttggcgaggtggtgcggttg |
27150046 |
T |
 |
| Q |
313 |
gattctctggctgctggttttttggttttgtgttgaagtttgttgttagccagttttaggtgcagaaggtggagtttcactatgacgttgaggtattctt |
412 |
Q |
| |
|
||| || |||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27150047 |
gatcgtccggctgctggttttttggttttgtgttgaggtttgttgctagccggttttaggtgcagaaggtggagtttcactatgacgttggggtattctt |
27150146 |
T |
 |
| Q |
413 |
atttttggtttcggttttagctagaagtttgttgtttcgctgtttggctcaagcaagt-----gtgtggatgttttaaattatcttggaatatgttaatt |
507 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| ||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27150147 |
atttttggtttcggtttcagctagaagcttgctgttttgctgtttggctcaagcaagtgtgtggtgtggatgttttaaattatgttggaatatgttaatt |
27150246 |
T |
 |
| Q |
508 |
agtaacatgttagatgggataggttgtttagtgctagctggtatgcttttttagttaggatgtgttgttgcttct |
582 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
27150247 |
agcaacatgttagatgggatgggttgtttagtgctagctggtgtgcttttgtagttaggatgtgttgttgcttct |
27150321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University